snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD83
sequence
GTCAAGTGATGTTTTCATTTTGAGAAATGAGTCTTTTGTGCAGTGCTGACCTTAATCAC
TCATCCTTGACTGACA
  Box motif
  Complementary to target RNA
length 75
organism Cavia_porcellus
snoRNA name SNORD83
alias
chromosome ⁄ contig scaffold_254188
locus ⁄ host gene Mono:533:SNORD83
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved