snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD73
sequence
TATAAGTGATGAAAAAATGTTTTGGTCCCAGTTGATGTCCACTGATAACTGTTACATTT
TTCTGATGTT
  Box motif
  Complementary to target RNA
length 69
organism Cavia_porcellus
snoRNA name SNORD73
alias
chromosome ⁄ contig scaffold_242598
locus ⁄ host gene Mono:314:SNORD73
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved