snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD45
sequence
GGTCAGTGATGAGATGGCATGTATTCTGAATCTAAAGTTGATTATTACTGCTTTAGCTC
TAGAATTACTCTGAGACCTG
  Box motif
  Complementary to target RNA
length 79
organism Cavia_porcellus
snoRNA name SNORD45
alias
chromosome ⁄ contig scaffold_2
locus ⁄ host gene LOC100715556
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved