snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA13
sequence
AGCCTTTGTGTTGCCCCTTCACCTTGGAAAGCTAGTGAATGTGGTGTCAAAAAAGGCAT
AAATAAAACTTTGCAGCTTTTTCCTGCCCTTATATTTGGTATATTTGGTGTAGGAGCTGC
ACAAGTAACAGTT
  Box motif
  Complementary to target RNA
length 132
organism Cavia_porcellus
snoRNA name SNORA13
alias
chromosome ⁄ contig GeneScaffold_7586
locus ⁄ host gene Mono:614:SNORA13
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved