snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD59
sequence
CCTCCCTGATGAAGTTTCTGACTTTTCGATCTTCTGAGTTTGCTGAAGCCAGATGCCAT
GCCAGAGAAGA
  Box motif
  Complementary to target RNA
length 70
organism Cavia_porcellus
snoRNA name SNORD59
alias
chromosome ⁄ contig GeneScaffold_7491
locus ⁄ host gene Mono:735:SNORD59
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved