snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA44
sequence
AAGCATGTGTCCAAGGACTGTGGCTGGTGTGGTCTTGAGATCTCCAACTGTGGGGGAGA
GCAACCTGGAAAGACTTTCAGCCCAGGATCTGTGGCTGCCACTCACCTTTTCTACAAAG
  Box motif
  Complementary to target RNA
length 118
organism Cavia_porcellus
snoRNA name SNORA44
alias
chromosome ⁄ contig GeneScaffold_1801
locus ⁄ host gene Mono:632:SNORA44
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved