snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA12
sequence
AGTTGTGATAGTCTCTTTCTGACACATTTGTTAAGTTTTCAAATGGGTCTGACTCTACC
ACATACATAATAAGGAGCTATCAAAAGCTTAAAGACGAAAATATCTCTCTTGAGCTTTTA
TTGTATCAGATATTGGCTCTCACAATC
  Box motif
  Complementary to target RNA
length 146
organism Cavia_porcellus
snoRNA name SNORA12
alias
chromosome ⁄ contig GeneScaffold_358
locus ⁄ host gene Mono:737:SNORA12
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved