snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORD35
sequence
GGCAGATTGATGGCTTTTTCTCACGATGGTCTGCGGATGTCACTGCGCAGTGCAGATAT
CGCCAAAGGTTCAGCTAGATGTCAGAAT
  Box motif
  Complementary to target RNA
length 87
organism Cavia_porcellus
snoRNA name SNORD35
alias
chromosome ⁄ contig scaffold_213334
locus ⁄ host gene Mono:16:SNORD35
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved