snOPY snoRNA Orthological Gene Database
Cavia_porcellus snoZ39
sequence
GTGCGTGTGATGGAGGCAAATCAGTATGAATAGAATCATGATACTGTAGACGCTTTCTG
ATGTG
  Box motif
  Complementary to target RNA
length 64
organism Cavia_porcellus
snoRNA name snoZ39
alias
chromosome ⁄ contig scaffold_288740
locus ⁄ host gene LOC100726711
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved