snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA41
sequence
GTCCACAGCTACTGGTCTGTCAATCGTAGCAGCTGTGGCATTCCACTGTAGGAAAGAAA
GTGTTACACAGTTAAATACCTCTTTCATACCCAAGAAGAAAGTGGGCATGTGAGTGACAG
TGTAAA
  Box motif
  Complementary to target RNA
length 125
organism Cavia_porcellus
snoRNA name SNORA41
alias
chromosome ⁄ contig scaffold_260352
locus ⁄ host gene LOC100734230
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved