snOPY snoRNA Orthological Gene Database
Cavia_porcellus SNORA5
sequence
TACAGTGGAGTCAAATTTGGCCTCGTGTCATCATGGTGGGAGCTGGCCAAGATGGCTGC
CACAGCAAACACCATTGCGCATGGACTCTGGGTCCACTGCCTGGACTCAGGGATAAGTTT
GACCGCAGACATAG
  Box motif
  Complementary to target RNA
length 133
organism Cavia_porcellus
snoRNA name SNORA5
alias
chromosome ⁄ contig scaffold_78958
locus ⁄ host gene
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved