snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD100
sequence
GCTGTACATGATGACAACTGGCTCCCTCTACTGAACTGCAGTGAGGAAACTGCCATGTC
ACCCTATCTGATTACAGC
  Box motif
  Complementary to target RNA
length 77
organism Canis_familiaris
snoRNA name SNORD100
alias
chromosome ⁄ contig 1
locus ⁄ host gene RPS12
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G436
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved