snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD57
sequence
TGAAGGTGATGAACTGTTTTAGCCTGACTTTGCATCGCAGAGGCAAAAAAACTAATATA
ATAAATATTT
  Box motif
  Complementary to target RNA
length 69
organism Canis_familiaris
snoRNA name SNORD57
alias
chromosome ⁄ contig 21
locus ⁄ host gene KIF18A
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved