snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA1
sequence
AGCCTCATTCTAGATGGTAATGGGCACTGTCCTTCATGGTGTCCAGAAATTGTTAATGT
GGCTACATTGAGACACAGGTTATGCTTCCATCACAGTAAGTTTATTGCTGTGGTGACAAT
GAGGCCTGTAACATTT
  Box motif
  Complementary to target RNA
length 135
organism Canis_familiaris
snoRNA name SNORA1
alias
chromosome ⁄ contig 21
locus ⁄ host gene ENSCAFG00000004233
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved