snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD110
sequence
TTGCAGTGATGACTTGAGTCTGTCAATCCCCTGAGTGCAATCACTGATGTCTCCATGTC
TCTGAGCAA
  Box motif
  Complementary to target RNA
length 68
organism Canis_familiaris
snoRNA name SNORD110
alias
chromosome ⁄ contig 24
locus ⁄ host gene NOL5A
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U1288
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved