snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD17
sequence
GTGAAGTGATGATTCAGTTTATCCATTCGCTGAGTGCACTGTACTGACCTTCTTCCAAG
CCTTGGTTCCTGTTCTAGGAACTCGGGGCTACGTAGCCTCCAAATGCCCTGCAGTTTGCG
GTGTTCTACCGTGGACAGCTTGTGTGTTGGTAGACTACTGGTTAGAATGGTTGGTGTCAG
TAGGGATGGGGTCCCTCTGGGTCCCATCTCACCAAGATGAGTGGTGGAAATCTGATCAC
  Box motif
  Complementary to target RNA
length 238
organism Canis_familiaris
snoRNA name SNORD17
alias
chromosome ⁄ contig 24
locus ⁄ host gene SNX5
organization Intronic
target RNA
modification type C/D
modification site 29S:U3133
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved