snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD73
sequence
AATGAGTGATGACAAAATGTTTCGGTCCCAAATGATACATATTGATTATACCGCTACAT
TTACTTCTGACATT
  Box motif
  Complementary to target RNA
length 73
organism Canis_familiaris
snoRNA name SNORD73
alias
chromosome ⁄ contig 15
locus ⁄ host gene Q9XST7_CANFA
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved