snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD37
sequence
GTAAGTGATGACTAAAATTTCTTCACTTTGACCTGATGGCTGTTGAAGAAAACTGACGT
CTGAGG
  Box motif
  Complementary to target RNA
length 65
organism Canis_familiaris
snoRNA name SNORD37
alias
chromosome ⁄ contig 20
locus ⁄ host gene EEF2
organization Intronic
target RNA
modification type C/D
modification site 28S:A3033
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved