snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD105
sequence
CTCCCAGCTCTCATGATGAACCCATATGCCTCTGAGCTGCCATGATTCTGGCTTCAAAG
TAAACGCTCTGAAGAGATGGAGCAGAGG
  Box motif
  Complementary to target RNA
length 87
organism Canis_familiaris
snoRNA name SNORD105
alias
chromosome ⁄ contig 20
locus ⁄ host gene ENSCAFG00000017917
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U799
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved