snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD53
sequence
ATGCTATGATGACATCCATATATGGTTTCGCTTCTGGCTGAGTTCCAGAGATGACACCT
TTCTCTTGGCTGTCTGAGCAT
  Box motif
  Complementary to target RNA
length 80
organism Canis_familiaris
snoRNA name SNORD53
alias
chromosome ⁄ contig 17
locus ⁄ host gene WDR43
organization Intronic
target RNA
modification type C/D
modification site 28S:G3174
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved