snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA42
sequence
GCATGGGTTTGGATTTATGGCAGGCTCGTCCCCCTGGGCCTCTCATAGTGTCCCATGCC
AGAGCAAACCATGGCCCCGAACCATTGCCTGGCCTCTGCCGTAGGCTGCAGGCACTGAAG
TGGGTCGCACAGTG
  Box motif
  Complementary to target RNA
length 133
organism Canis_familiaris
snoRNA name SNORA42
alias
chromosome ⁄ contig 17
locus ⁄ host gene ODC1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved