snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD45
sequence
GGTCAGTGATGTGTTGGCATGTATTACCTGACTAAATGGCTGATGTGTGATAACACAAG
CTCTAGAATTACGCTGAGACCTT
  Box motif
  Complementary to target RNA
length 82
organism Canis_familiaris
snoRNA name SNORD45
alias
chromosome ⁄ contig 6
locus ⁄ host gene RABGGTB
organization Intronic
target RNA
modification type C/D
modification site 18S:U172,18S:A159
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved