snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA66
sequence
GTGCAAACTCGATCACTAGCTCTGCATGATGTTGCAGAAGTGAGGGGAACCAGGTTTGC
TAAAGTAATTGTGGTGATAGAAATGTATTAGCCTCAGAAGGTACTTACTGAGCTGACCTA
TTCTATCCCATTACAGTG
  Box motif
  Complementary to target RNA
length 137
organism Canis_familiaris
snoRNA name SNORA66
alias
chromosome ⁄ contig 6
locus ⁄ host gene RPL5
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved