snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD83
sequence
GCCAAATGATGTTTATTTGATAGAGGAGCACTTTAGTGCCAGGACGACTCTTAATCTAT
CACCCATGACTGATGGCT
  Box motif
  Complementary to target RNA
length 77
organism Canis_familiaris
snoRNA name SNORD83
alias
chromosome ⁄ contig 12
locus ⁄ host gene UAP56_CANFA
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved