snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD102
sequence
AGCTTAATGATGATTGTCTTTTTGATTGCTTGAAGCAATGTGAAAAACACATTTCACCG
GCTCTGAAAGCT
  Box motif
  Complementary to target RNA
length 71
organism Canis_familiaris
snoRNA name SNORD102
alias
chromosome ⁄ contig 25
locus ⁄ host gene ENSCAFG00000006810
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G3353
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved