snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD58
sequence
CCGCGATGATGGCATTTCTTAGGACACCTTTGGATTAACCGTGAGAACAGCTATCAGCT
GAGCGGC
  Box motif
  Complementary to target RNA
length 66
organism Canis_familiaris
snoRNA name SNORD58
alias
chromosome ⁄ contig 7
locus ⁄ host gene ENSCAFG00000019044
organization Intronic
target RNA
modification type C/D
modification site 28S:G3537
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved