snOPY snoRNA Orthological Gene Database
Canis_familiaris snoMBII-202
sequence
TGATGACAGTCTCCGGAATCGCTGTACTCACGTGATGAAAGTACACTCGAACCCTTTTC
CATCTGACGGCCAAGCGCGGC
  Box motif
  Complementary to target RNA
length 80
organism Canis_familiaris
snoRNA name snoMBII-202
alias
chromosome ⁄ contig 5
locus ⁄ host gene RPL13
organization Intronic
target RNA 28S rRNA, 18S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved