snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD49
sequence
TGCTCTGATGAAATCACTTATAGGAAGTGCCGTCAGAAGCGATAACTGACGATAACCTT
TCCTGGCTGACT
  Box motif
  Complementary to target RNA
length 71
organism Canis_familiaris
snoRNA name SNORD49
alias
chromosome ⁄ contig 5
locus ⁄ host gene poly:SNORD49
organization Poly
target RNA
modification type C/D
modification site 28S:C3765
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved