snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD96
sequence
CATCCCAGTGATGACAGATGACATTGTCAGCCAATCCCTACGTGGGAGTGAGGACATGT
CCTGCAATTCTGAAGGGATA
  Box motif
  Complementary to target RNA
length 79
organism Canis_familiaris
snoRNA name SNORD96
alias
chromosome ⁄ contig 11
locus ⁄ host gene TRIM7
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved