snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD36
sequence
TTGACAATGATGCAGGAATTTCTTCACCTGGAATCTCTGTGAAGAGTAAAATCGAGCTT
TTTAACCCTGAGTCACA
  Box motif
  Complementary to target RNA
length 76
organism Canis_familiaris
snoRNA name SNORD36
alias
chromosome ⁄ contig 9
locus ⁄ host gene Q9XST8_CANFA
organization Intronic
target RNA
modification type C/D
modification site 18S:A668
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved