snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD42
sequence
ATGCAAATGATGGAAAAGTCACTATTTAGGAAAGAATGACATGAACAAAGGAACTGCTG
ATGTGC
  Box motif
  Complementary to target RNA
length 65
organism Canis_familiaris
snoRNA name SNORD42
alias
chromosome ⁄ contig 9
locus ⁄ host gene RPL23A
organization Intronic
target RNA
modification type C/D
modification site 18S:U116
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved