snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA36
sequence
TTCCAAAGTGTTGAGTTCAGTTCAGGGCAGCTTCCCTGTTCTGTTAATTAGACTTTGGA
ACATTGAAGCCTGGGCCGTGAGAGGTGGTTGGATAGAACGCATTACTCTATTCATTTCCT
ACCTCTCAGCCTACAGAA
  Box motif
  Complementary to target RNA
length 137
organism Canis_familiaris
snoRNA name SNORA36
alias
chromosome ⁄ contig X
locus ⁄ host gene ENSCAFG00000019620
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved