snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA43
sequence
CAGGTGCTGGACCTACTAGCACCACAGATACAGCTGCTTTGCTGCACCTGGGATGTCAG
GGCAAAGAGGAAGTGGCTATTTCTACGCTCAGTGCTCAGAACAGTGGGCACTAAGAATGG
TTTGTAGCCAAACATGC
  Box motif
  Complementary to target RNA
length 136
organism Canis_familiaris
snoRNA name SNORA43
alias
chromosome ⁄ contig 9
locus ⁄ host gene Poly:6:SNORA17
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved