snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD45
sequence
GGTCAGCAATGTGATGGCCTGTGTTAGCTGAATCCAAAGTTGATGTAAATTCTAAAATT
ACACGAAAACCTT
  Box motif
  Complementary to target RNA
length 72
organism Canis_familiaris
snoRNA name SNORD45
alias
chromosome ⁄ contig 21
locus ⁄ host gene Mono:163:SNORD45
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved