snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD52
sequence
GAGAATGATGATTTCTCAGGCTAGAGTCTCTGACACTGGTCTTGATGACAAAAATTAAG
TTCTGACTC
  Box motif
  Complementary to target RNA
length 68
organism Canis_familiaris
snoRNA name SNORD52
alias
chromosome ⁄ contig 17
locus ⁄ host gene Mono:110:SNORD52
organization Mono
target RNA
modification type C/D
modification site 28S:U3240
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved