snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA65
sequence
CCCGCCACTGCACCTGATCAGTTTTCTGTTGGCTGGTGCAATCCAGTGGTGAGCTGATA
GTAAACCCCAGCTTAGGAAACAGGGTTGTTCTTCATGTGGATGACTCTGTGCCGAAAGCA
TGGGAACAGCC
  Box motif
  Complementary to target RNA
length 130
organism Canis_familiaris
snoRNA name SNORA65
alias
chromosome ⁄ contig 28
locus ⁄ host gene Mono:43:SNORA65
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved