snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD48
sequence
AGTGATGATGAACCCCGGTGACTCTGAGTGTCTCGCTGACGCCATCACCGCAGCGCGCT
GACC
  Box motif
  Complementary to target RNA
length 63
organism Canis_familiaris
snoRNA name SNORD48
alias
chromosome ⁄ contig 12
locus ⁄ host gene Poly:15:SNORD48
organization Poly
target RNA
modification type C/D
modification site 28S:C1705
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved