snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA71
sequence
TCCTGCATTCGAAAGTGATCGTGGGCTGCCTGTGCCCTGGTCATTGATAGTGCAGGGAG
AGGAATTGCTGAAAGCACATCCCCGTGTTAGAAGGGCCCATCCCATCCCTTCCAAACCCT
GGAGCTTTCATACA
  Box motif
  Complementary to target RNA
length 133
organism Canis_familiaris
snoRNA name SNORA71
alias
chromosome ⁄ contig 24
locus ⁄ host gene Poly:21:SNORA71
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved