snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD47
sequence
AACCAGTGATGTAGTGATTCTGCCAAATGAAATAGAATGATATCACTCATAAAACCGTT
CCATTTTGATTCTGAGGTT
  Box motif
  Complementary to target RNA
length 78
organism Canis_familiaris
snoRNA name SNORD47
alias
chromosome ⁄ contig 7
locus ⁄ host gene Poly:12:SNORD74
organization Poly
target RNA
modification type C/D
modification site 28S:C3202
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved