snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA1
sequence
TCTCTCAAATCTTTAAAAACAATAAAAATTTTTTAAAAAGTTTTGTGGCTATATTGAAA
CACAAGTTATGCTTTCATCACAGCAGATCTATTGCAGTGGTGACAATGAGACTTGTAACA
TTT
  Box motif
  Complementary to target RNA
length 122
organism Canis_familiaris
snoRNA name SNORA1
alias
chromosome ⁄ contig 10
locus ⁄ host gene Mono:134:SNORA1
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved