snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD12
sequence
GCTGGTGTAAATGATGACTGAGCTTTTTTCCCCATCAGATCGACAATGCTGAGGTCTTT
GAACACTTGCCAGTTAGTTCTGATGCACCGGC
  Box motif
  Complementary to target RNA
length 91
organism Canis_familiaris
snoRNA name SNORD12
alias
chromosome ⁄ contig 24
locus ⁄ host gene Poly:23:SNORD12
organization Poly
target RNA
modification type C/D
modification site 28S:G3214
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved