snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA70
sequence
CTGTAGCCAAGGAAACCACCATGTGCTCCCTCCACAGGGAGCCTGGTGTGCAATGGTGG
CAAACAGTAGCCCCCTCAGTAGTGTATACAGCCTGTTGCTTAAATGGGTTGCCTTACAGG
ACTTTGGACACAGCC
  Box motif
  Complementary to target RNA
length 134
organism Canis_familiaris
snoRNA name SNORA70
alias
chromosome ⁄ contig 26
locus ⁄ host gene Mono:100:SNORA70
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved