snOPY snoRNA Orthological Gene Database
Canis_familiaris SCARNA9
sequence
TCTCTGAGATCTGCTCTTACTGAAGTGGATCGATGATGAAAATAGCCCAAATTTGATTA
TCAGAAGCCCTTCTGGTCTACCTGATGCATGATCTCCATAGTTCTGAGAAGGAAAGGTAA
CTTAGAACAGTAAAGACTTACGTCAGTAGCTGTGTATGCCAAGATGACAGTGTATAACTG
ATGACTTAATGAGTGACATTGGAATGAGGGTGGAGGAGGTATGTGTATAGATGAAAGACG
AATCAGTTCTGAGCCATGATGGAAAGGTTTTACTCTTGACATTTACAACTATGAAGATTT
CTACACTTGATCTGAGCTCA
  Box motif
  Complementary to target RNA
length 319
organism Canis_familiaris
snoRNA name SCARNA9
alias
chromosome ⁄ contig 33
locus ⁄ host gene mono: SCARNA9
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved