snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD30
sequence
ATCCATGATGACTTATGTGGAATCTCGTTCGGCTGATAACTTGCTGTTGAGACTCGGAA
TTCTGACTTTC
  Box motif
  Complementary to target RNA
length 70
organism Canis_familiaris
snoRNA name SNORD30
alias
chromosome ⁄ contig 18
locus ⁄ host gene Poly:24:SNORD25
organization Poly
target RNA
modification type C/D
modification site 28S:3140
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved