snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD25
sequence
CTCTCTGTGATGAGAACCTTTCACAGACCTGTACTGATCTCCGTGAGGATAAAAAAAAC
TCTGAGGAG
  Box motif
  Complementary to target RNA
length 68
organism Canis_familiaris
snoRNA name SNORD25
alias
chromosome ⁄ contig 18
locus ⁄ host gene Poly:24:SNORD25
organization Poly
target RNA
modification type C/D
modification site 18S:1490
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved