snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORA72
sequence
CTGCTCTTAAAAAGTGTATTCAAAGATTTTTTTAATGCAGGGGGACATTTGCTATATTA
AGATCACACATGTGTCTCCAGACCTAATTCTTTCTCTAGGTCTGGTTTTATAAAGACTGA
TGATAAAC
  Box motif
  Complementary to target RNA
length 127
organism Canis_familiaris
snoRNA name SNORA72
alias
chromosome ⁄ contig Un
locus ⁄ host gene Mono:4:SNORA72
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved