snOPY snoRNA Orthological Gene Database
Canis_familiaris snoR38
sequence
ACAAGCCTATGATGGTTTAGTTATCCCTGTCTGAAAATCTCGACTGAAGGGAAACCGTG
TATTCTGAGGCTTCA
  Box motif
  Complementary to target RNA
length 74
organism Canis_familiaris
snoRNA name snoR38
alias
chromosome ⁄ contig 9
locus ⁄ host gene Poly:3:snoR38
organization Poly
target RNA 28S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved