snOPY snoRNA Orthological Gene Database
Canis_familiaris SNORD21
sequence
ACTGAATGACATCCCACCAATTGAGCAGTCAGTAGTTGGTTTGGTTGCATATGATGCGG
TTAAATTGATCCAAGATGGGACTGATACCAGG
  Box motif
  Complementary to target RNA
length 91
organism Canis_familiaris
snoRNA name SNORD21
alias
chromosome ⁄ contig 32
locus ⁄ host gene Mono:142:SNORD21
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved