snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans CeSSU-970
sequence
CGCTTCATGGTGCATTACACTTTGTAACTTGCATTGTGTGCGCGACTAATGAAGCAATA
CCAATATCTGCAGTATCTGCTCATTCGCCGTGTTGTAGTTGATGAGCTCGTAGTCCGATA
ACAATT
  Box motif
  Complementary to target RNA
length 125
organism Caenorhabditis_elegans
snoRNA name CeSSU-970
alias CeN64
chromosome ⁄ contig
locus ⁄ host gene C05D2.6
organization Intronic
target RNA 26S rRNA, 18S rRNA
modification type H/ACA
modification site 18S:U970,26S:U2847
accession no AM051028
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved