snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y43F8C.22
sequence
CCACCCACGGCAACAAATTCCAATTGTGTGTAACATTCAATGCAATTGAGCCGACGCCG
TGGGAAATCACTTTCGTGGAACCATTTGATCCCACGCTCGTTACTGTTAATGATTGTGGT
TTGCACGTGGTTTACAATT
  Box motif
  Complementary to target RNA
length 138
organism Caenorhabditis_elegans
snoRNA name Y43F8C.22
alias CeN125
chromosome ⁄ contig V
locus ⁄ host gene Y43F8C.7
organization Intronic
target RNA 26S rRNA, 18S rRNA
modification type H/ACA
modification site 18S:U1146,26S:U940
accession no AM051030,NR_003483
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved